ID: 1144579445_1144579464

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1144579445 1144579464
Species Human (GRCh38) Human (GRCh38)
Location 17:16450192-16450214 17:16450245-16450267
Sequence CCCATTATGCAGTGGGGGAGCCT GCTGATGGGAAGGCAAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103} {0: 1, 1: 0, 2: 3, 3: 56, 4: 512}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!