ID: 1144581070_1144581077

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1144581070 1144581077
Species Human (GRCh38) Human (GRCh38)
Location 17:16459895-16459917 17:16459942-16459964
Sequence CCCACTCTGGCTGGCTCTGATTT GTGTTGAAGTGGTCTGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 247} {0: 1, 1: 0, 2: 0, 3: 19, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!