ID: 1144610370_1144610375

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1144610370 1144610375
Species Human (GRCh38) Human (GRCh38)
Location 17:16706876-16706898 17:16706892-16706914
Sequence CCTAGATACCTGTTTACCTGGGG CCTGGGGAAAGATGAGGATGAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 6, 4: 105} {0: 4, 1: 0, 2: 5, 3: 81, 4: 659}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!