ID: 1144611038_1144611039

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1144611038 1144611039
Species Human (GRCh38) Human (GRCh38)
Location 17:16715858-16715880 17:16715873-16715895
Sequence CCAGGCTTGTGGATTGGAGCGAG GGAGCGAGTTTGTGTTTAATTGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 0, 3: 5, 4: 86} {0: 3, 1: 1, 2: 1, 3: 28, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!