ID: 1144620704_1144620714

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1144620704 1144620714
Species Human (GRCh38) Human (GRCh38)
Location 17:16816723-16816745 17:16816765-16816787
Sequence CCTGAGGTGGAAACAAGCAAAGT CTGTGTGGCTAAAGGGCAGTGGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 5, 3: 31, 4: 322} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!