ID: 1144638984_1144638992

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1144638984 1144638992
Species Human (GRCh38) Human (GRCh38)
Location 17:16927264-16927286 17:16927296-16927318
Sequence CCTGGATGTGGGATCAGGCTGGG ATGGGCAGACATTGCCATCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!