ID: 1144641115_1144641121

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1144641115 1144641121
Species Human (GRCh38) Human (GRCh38)
Location 17:16937358-16937380 17:16937391-16937413
Sequence CCAAAGAAACACCACCACAAGAT ATTGAAGCTGGGGTTGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 229} {0: 1, 1: 0, 2: 0, 3: 20, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!