ID: 1144645785_1144645796

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1144645785 1144645796
Species Human (GRCh38) Human (GRCh38)
Location 17:16972476-16972498 17:16972529-16972551
Sequence CCTGCTCTTCCTTCAAGGCTCCA CCTGACTGTCCCAGCCTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 464} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!