ID: 1144658073_1144658082

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1144658073 1144658082
Species Human (GRCh38) Human (GRCh38)
Location 17:17050793-17050815 17:17050814-17050836
Sequence CCTTGCCAGGGCCTCAGGCCTGT GTCCTGTGGGGAGCCGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 548} {0: 1, 1: 0, 2: 2, 3: 20, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!