ID: 1144658229_1144658243

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1144658229 1144658243
Species Human (GRCh38) Human (GRCh38)
Location 17:17051671-17051693 17:17051712-17051734
Sequence CCCATGCCCTACCCAGAGCTCTC TTGGGGGCAAGAGCACCTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 241} {0: 1, 1: 0, 2: 1, 3: 10, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!