ID: 1144670469_1144670476

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1144670469 1144670476
Species Human (GRCh38) Human (GRCh38)
Location 17:17129968-17129990 17:17129986-17130008
Sequence CCAGCCAGCCTTGATGAGAAGTG AAGTGTGACCAGGGAGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 186} {0: 1, 1: 1, 2: 3, 3: 52, 4: 467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!