ID: 1144673442_1144673448

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1144673442 1144673448
Species Human (GRCh38) Human (GRCh38)
Location 17:17146036-17146058 17:17146066-17146088
Sequence CCCGACCTGCTGAATTTCAAGAA CTGACTAAGCAGTATGAGGACGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 15, 4: 222} {0: 1, 1: 0, 2: 0, 3: 10, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!