ID: 1144675577_1144675583

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1144675577 1144675583
Species Human (GRCh38) Human (GRCh38)
Location 17:17159315-17159337 17:17159356-17159378
Sequence CCGATGGCAGGAGGGGCGCGAGC TACGCAGCCCTGGCTTGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 120} {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!