ID: 1144677220_1144677225

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1144677220 1144677225
Species Human (GRCh38) Human (GRCh38)
Location 17:17169384-17169406 17:17169404-17169426
Sequence CCTCCACACCGAGGCTGCTTTAG TAGGTTAGCCAACCAGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 345} {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!