ID: 1144677873_1144677884

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1144677873 1144677884
Species Human (GRCh38) Human (GRCh38)
Location 17:17173447-17173469 17:17173469-17173491
Sequence CCCACCTGGAAGCCCCTCATCCC CTGGTTCACCTGCAGGAGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 302} {0: 1, 1: 0, 2: 4, 3: 34, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!