|
Left Crispr |
Right Crispr |
| Crispr ID |
1144683491 |
1144683501 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:17210924-17210946
|
17:17210966-17210988
|
| Sequence |
CCAGTTGGCAGCTGGGTGCGGTG |
GCACTTTAGGAGGCCGAGGCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 7, 3: 49, 4: 319} |
{0: 1734, 1: 91513, 2: 228341, 3: 236978, 4: 163327} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|