ID: 1144684385_1144684390

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1144684385 1144684390
Species Human (GRCh38) Human (GRCh38)
Location 17:17216357-17216379 17:17216375-17216397
Sequence CCACAGCCCGCGGGGGCACGCAC CGCACCTGAGGAGAGCACGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 136} {0: 1, 1: 0, 2: 0, 3: 0, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!