ID: 1144689647_1144689654

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1144689647 1144689654
Species Human (GRCh38) Human (GRCh38)
Location 17:17252282-17252304 17:17252310-17252332
Sequence CCTTTCATTCCAGAAGGGTTTCT CTGGCAGTCCTGACATTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 281} {0: 1, 1: 0, 2: 4, 3: 29, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!