ID: 1144694740_1144694746 |
View in Genome Browser |
Spacer: 6 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1144694740 | 1144694746 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 17:17295144-17295166 | 17:17295173-17295195 |
Sequence | CCGGCCTCATTCTCTTTTTTCTT | GGGGCCTCACTCTGTTGCCCAGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 2, 2: 37, 3: 488, 4: 4263} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |