ID: 1144694740_1144694746

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1144694740 1144694746
Species Human (GRCh38) Human (GRCh38)
Location 17:17295144-17295166 17:17295173-17295195
Sequence CCGGCCTCATTCTCTTTTTTCTT GGGGCCTCACTCTGTTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 37, 3: 488, 4: 4263} {0: 32, 1: 1268, 2: 20783, 3: 71086, 4: 172427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!