ID: 1144699124_1144699127

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1144699124 1144699127
Species Human (GRCh38) Human (GRCh38)
Location 17:17325311-17325333 17:17325332-17325354
Sequence CCCTCTGAGCTCCAGACACTCAG AGACCCGATGTATCTGTCCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 28, 4: 334} {0: 1, 1: 0, 2: 0, 3: 6, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!