ID: 1144722751_1144722756

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1144722751 1144722756
Species Human (GRCh38) Human (GRCh38)
Location 17:17483594-17483616 17:17483636-17483658
Sequence CCCGCAGTTGAATGAAAAATTAA TTTAAAGAATGAGGAAAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 372} {0: 1, 1: 0, 2: 7, 3: 95, 4: 994}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!