ID: 1144722752_1144722754

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1144722752 1144722754
Species Human (GRCh38) Human (GRCh38)
Location 17:17483595-17483617 17:17483632-17483654
Sequence CCGCAGTTGAATGAAAAATTAAA TATTTTTAAAGAATGAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 64, 4: 723} {0: 1, 1: 0, 2: 10, 3: 99, 4: 1078}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!