ID: 1144726964_1144726971

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1144726964 1144726971
Species Human (GRCh38) Human (GRCh38)
Location 17:17506928-17506950 17:17506941-17506963
Sequence CCCAGGAGCCCCCGGTCACCCCA GGTCACCCCAGCCCAGAGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 203} {0: 1, 1: 0, 2: 3, 3: 34, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!