ID: 1144732451_1144732457

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1144732451 1144732457
Species Human (GRCh38) Human (GRCh38)
Location 17:17536586-17536608 17:17536615-17536637
Sequence CCAGCAAAGGTGACCTCATGGGA ATGCCCTGGCTGGCTCCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 172} {0: 1, 1: 0, 2: 1, 3: 23, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!