ID: 1144738809_1144738825

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1144738809 1144738825
Species Human (GRCh38) Human (GRCh38)
Location 17:17569819-17569841 17:17569860-17569882
Sequence CCCATGCTGGCTCCCTCGGGACA CAGGGCAAGCAGGGGGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112} {0: 1, 1: 1, 2: 5, 3: 50, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!