ID: 1144738813_1144738825

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1144738813 1144738825
Species Human (GRCh38) Human (GRCh38)
Location 17:17569831-17569853 17:17569860-17569882
Sequence CCCTCGGGACAACACAGGGCATG CAGGGCAAGCAGGGGGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 83} {0: 1, 1: 1, 2: 5, 3: 50, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!