|
Left Crispr |
Right Crispr |
| Crispr ID |
1144757144 |
1144757148 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:17686566-17686588
|
17:17686603-17686625
|
| Sequence |
CCCGTGTGTGTGTGTGTGTGTGT |
GTGTGTGCACGCGCGCGCCGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1491, 1: 2524, 2: 3655, 3: 5497, 4: 10599} |
{0: 1, 1: 2, 2: 8, 3: 44, 4: 169} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|