|
Left Crispr |
Right Crispr |
| Crispr ID |
1144757867 |
1144757870 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:17691185-17691207
|
17:17691199-17691221
|
| Sequence |
CCATGTCAGGAGACATTTTTGGT |
ATTTTTGGTTGTCTCAGCTGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 21, 2: 56, 3: 108, 4: 254} |
{0: 1, 1: 26, 2: 159, 3: 504, 4: 1064} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|