ID: 1144757867_1144757872

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1144757867 1144757872
Species Human (GRCh38) Human (GRCh38)
Location 17:17691185-17691207 17:17691211-17691233
Sequence CCATGTCAGGAGACATTTTTGGT CTCAGCTGGGGAGGTGCTGCTGG
Strand - +
Off-target summary {0: 2, 1: 21, 2: 56, 3: 108, 4: 254} {0: 1, 1: 0, 2: 5, 3: 38, 4: 542}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!