|
Left Crispr |
Right Crispr |
Crispr ID |
1144757867 |
1144757874 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:17691185-17691207
|
17:17691222-17691244
|
Sequence |
CCATGTCAGGAGACATTTTTGGT |
AGGTGCTGCTGGCATCTAGTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 21, 2: 56, 3: 108, 4: 254} |
{0: 4, 1: 75, 2: 338, 3: 805, 4: 1601} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|