ID: 1144759151_1144759153

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1144759151 1144759153
Species Human (GRCh38) Human (GRCh38)
Location 17:17697544-17697566 17:17697572-17697594
Sequence CCGAGATTGATGTGCTGAACATG TTTATCTGGATTTGCTCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 264} {0: 1, 1: 0, 2: 1, 3: 29, 4: 412}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!