ID: 1144759280_1144759285

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1144759280 1144759285
Species Human (GRCh38) Human (GRCh38)
Location 17:17698306-17698328 17:17698334-17698356
Sequence CCACTCAAGAGTTGAGTCCCACC TCAAGAACAGCAAGGAATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 66} {0: 1, 1: 0, 2: 0, 3: 37, 4: 466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!