ID: 1144762758_1144762761

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1144762758 1144762761
Species Human (GRCh38) Human (GRCh38)
Location 17:17716766-17716788 17:17716785-17716807
Sequence CCTCCTGTGTGGTGCTGCTGGAC GGACTCTGTTGTGGTCACCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 222} {0: 1, 1: 0, 2: 1, 3: 14, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!