ID: 1144762859_1144762873

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1144762859 1144762873
Species Human (GRCh38) Human (GRCh38)
Location 17:17717229-17717251 17:17717262-17717284
Sequence CCCAGCCCCTTGGTGGCTTCCTG AAGTTTGAGCCCTGGGAACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 384} {0: 1, 1: 0, 2: 1, 3: 18, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!