ID: 1144762860_1144762873

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1144762860 1144762873
Species Human (GRCh38) Human (GRCh38)
Location 17:17717230-17717252 17:17717262-17717284
Sequence CCAGCCCCTTGGTGGCTTCCTGG AAGTTTGAGCCCTGGGAACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 355} {0: 1, 1: 0, 2: 1, 3: 18, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!