ID: 1144769357_1144769364

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1144769357 1144769364
Species Human (GRCh38) Human (GRCh38)
Location 17:17750985-17751007 17:17751004-17751026
Sequence CCTTCCGCCTTCCACAGAGGAGG GAGGAAGATGGGTACACATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 282} {0: 1, 1: 2, 2: 0, 3: 15, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!