ID: 1144771054_1144771062

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1144771054 1144771062
Species Human (GRCh38) Human (GRCh38)
Location 17:17759862-17759884 17:17759909-17759931
Sequence CCACTAGGATGCTGTAATCTTGA GTAAGATTTGTGCTTATTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 96} {0: 1, 1: 0, 2: 3, 3: 16, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!