ID: 1144771158_1144771165

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1144771158 1144771165
Species Human (GRCh38) Human (GRCh38)
Location 17:17760416-17760438 17:17760442-17760464
Sequence CCCAGACTGTACCCAGAAGTTTG CAGCCCAGTGTCCCTGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 163} {0: 1, 1: 0, 2: 4, 3: 57, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!