ID: 1144772088_1144772094

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1144772088 1144772094
Species Human (GRCh38) Human (GRCh38)
Location 17:17765644-17765666 17:17765657-17765679
Sequence CCCTGCAAGTCACCCGTTTCACA CCGTTTCACAAGAGGGAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108} {0: 1, 1: 0, 2: 0, 3: 9, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!