ID: 1144779446_1144779464

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1144779446 1144779464
Species Human (GRCh38) Human (GRCh38)
Location 17:17800501-17800523 17:17800554-17800576
Sequence CCGACCACCCCATCCTGTCCCTG CACAAGGTCCTGCTGGACTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 70, 4: 751} {0: 1, 1: 0, 2: 3, 3: 8, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!