ID: 1144794668_1144794673

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1144794668 1144794673
Species Human (GRCh38) Human (GRCh38)
Location 17:17882931-17882953 17:17882948-17882970
Sequence CCACCCCATGCAGCACTTCCCCA TCCCCAAGGCTGCCCACGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 389} {0: 1, 1: 0, 2: 0, 3: 17, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!