ID: 1144801997_1144802002

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1144801997 1144802002
Species Human (GRCh38) Human (GRCh38)
Location 17:17935684-17935706 17:17935721-17935743
Sequence CCTTATTATACCATCTCTAAAGT ATCATGCTCCAAGAGCCATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 214} {0: 1, 1: 0, 2: 0, 3: 14, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!