ID: 1144802566_1144802568

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1144802566 1144802568
Species Human (GRCh38) Human (GRCh38)
Location 17:17940576-17940598 17:17940597-17940619
Sequence CCTGAACAAAGAGCAGGAATAAG AGGTAAGCCTGAAAGAATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 360} {0: 1, 1: 0, 2: 2, 3: 21, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!