ID: 1144808641_1144808656

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1144808641 1144808656
Species Human (GRCh38) Human (GRCh38)
Location 17:17984500-17984522 17:17984553-17984575
Sequence CCTTCTGCTGGCCTCTTAGGAGC CCTAGCAGGGAGAAGGTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 209} {0: 1, 1: 0, 2: 2, 3: 25, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!