ID: 1144814645_1144814654

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1144814645 1144814654
Species Human (GRCh38) Human (GRCh38)
Location 17:18025513-18025535 17:18025531-18025553
Sequence CCTCCCTCACCTTCCTCTCACCC CACCCTAGTAGGGCACAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 19, 3: 232, 4: 1949} {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!