ID: 1144825421_1144825433

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1144825421 1144825433
Species Human (GRCh38) Human (GRCh38)
Location 17:18103101-18103123 17:18103136-18103158
Sequence CCTCAGGTCCTCTCCTCCTGCTG TTGAGGGGCTGCCATCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 76, 4: 781} {0: 1, 1: 0, 2: 0, 3: 12, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!