ID: 1144825748_1144825758

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1144825748 1144825758
Species Human (GRCh38) Human (GRCh38)
Location 17:18104825-18104847 17:18104870-18104892
Sequence CCTGGGGCTGCGTCTGCAGCACC CTCTGACCTCTACTGTGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 367} {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!