ID: 1144834249_1144834259

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1144834249 1144834259
Species Human (GRCh38) Human (GRCh38)
Location 17:18148637-18148659 17:18148685-18148707
Sequence CCCCAGAGGGTCCCATAGGGTCC TTATAACCCAGGATCTCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128} {0: 1, 1: 0, 2: 4, 3: 4, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!