ID: 1144838760_1144838762

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1144838760 1144838762
Species Human (GRCh38) Human (GRCh38)
Location 17:18172735-18172757 17:18172751-18172773
Sequence CCCTGGTATCTCTGTGTATCCAA TATCCAAATTTCCTCTTATAAGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 11, 3: 32, 4: 219} {0: 2, 1: 12, 2: 36, 3: 113, 4: 386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!