|
Left Crispr |
Right Crispr |
| Crispr ID |
1144838760 |
1144838766 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:18172735-18172757
|
17:18172773-18172795
|
| Sequence |
CCCTGGTATCTCTGTGTATCCAA |
GACATCTGTCATATTGGAGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 3, 2: 11, 3: 32, 4: 219} |
{0: 1, 1: 7, 2: 82, 3: 545, 4: 1519} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|